:py:mod:`labtools.adtools.finder`
=================================

.. py:module:: labtools.adtools.finder


Module Contents
---------------


Functions
~~~~~~~~~

.. autoapisummary::

   labtools.adtools.finder.pull_AD
   labtools.adtools.finder.pull_barcode



.. py:function:: pull_AD(read, barcoded=False, ad_preceder='GCTAGC', bc_preceder='GGGCCCG', bc_anteceder='GGAGAGAA', ad_length=120, bclength=11, **kwargs)

   Find the activation domain tile in a read.

   Takes a read sequence and uses customizable anchor sequences to locate a
   variable sequence (AD/seq of interest) in the read. Includes support for barcodes.

   :param read: The biological read of interest.
   :type read: str
   :param barcoded: Whether or not the sequence includes a barcode in addition to the AD/seq of interest.
   :type barcoded: bool, default False
   :param ad_preceder: The anchor sequence directly before the AD.
   :type ad_preceder: str, default "GCTAGC"
   :param bc_preceder: The anchor sequence directly before the barcode.
   :type bc_preceder: str, default "GGGCCCG"
   :param bc_anteceder: The anchor sequence directly after the barcode.
   :type bc_anteceder: str, default "GGAGAGAA"
   :param ad_length: The length of the AD/seq of interest.
   :type ad_length: int, default 120
   :param bc_length: The length of the barcode sequence if used.
   :type bc_length: int, default 11

   :returns: * **AD** (*str*) -- The sequence of interest, if located. Else None.
             * **barcode** (*str*) -- The barcode, if used and located. Else None.

   .. rubric:: Examples

   >>> pull_AD("ACTTTTATVGCTAGCATGGCTGGTAGATCTTGGTTGATTGATTCTAATAGAATTGCTACTAAGATTATGTCTGCTTCTGCTTCTTCTGATCCAAGACAAGTTGTTTGGAAATCTAATCCATCTAGACATTGTCCAGCTGATCGATGCTAGTAGAGAGAGA")
   ATGGCTGGTAGATCTTGGTTGATTGATTCTAATAGAATTGCTACTAAGATTATGTCTGCTTCTGCTTCTTCTGATCCAAGACAAGTTGTTTGGAAATCTAATCCATCTAGACATTGTCCA


.. py:function:: pull_barcode(read, bc_preceder='GGGCCCG', bc_anteceder='GGAGAGAA', bclength=11, **kwargs)

   Find the barcode in a read.

   Takes a read sequence and uses customizable anchor sequences to locate a
   variable sequence (barcode) in the read.

   :param read: The biological read of interest.
   :type read: str
   :param bc_preceder: The anchor sequence directly before the barcode.
   :type bc_preceder: str, default "GGGCCCG"
   :param bc_anteceder: The anchor sequence directly after the barcode.
   :type bc_anteceder: str, default "GGAGAGAA"
   :param bc_length: The length of the barcode sequence if used.
   :type bc_length: int, default 11

   :returns: **barcode** -- The barcode, if used and located. Else None.
   :rtype: str

   .. rubric:: Examples

   >>> pull_barcode("ACTTTTATVGCTAGCATGGCTGGTAGATCTTGGTTGATTGATTCTAATAGAATTGCTACTAAGATTATGTCTGCTTCTGCTTCTTCTGATCCAAGACAAGTTGTTTGGAAATCTAATCCATCTAGACATTGTCCAGCTGATCGATGCTAGTAGAGAGAGA")
   ATGGCTGGTAGATCTTGGTTGATTGATTCTAATAGAATTGCTACTAAGATTATGTCTGCTTCTGCTTCTTCTGATCCAAGACAAGTTGTTTGGAAATCTAATCCATCTAGACATTGTCCA